Primer3 Output


PRIMER PICKING RESULTS FOR Ali's sequence

No mispriming library specified
Using 1-based sequence positions
OLIGO            start  len      tm     gc%   any    3' seq 
LEFT_PRIMER         21   20   59.96   50.00  2.00  0.00 cgcacaatcccactatcctt
SEQUENCE SIZE: 210
INCLUDED REGION SIZE: 210

    1 tccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctata
                          >>>>>>>>>>>>>>>>>>>>                    

   61 taaggaagttcatttcatttggagaggacacgctgaaatcaccagtctctctctacaaat
                                                                  

  121 ctatctctctctattttctccataataatgtgtgagtagttcccagataagggaattagg
                                                                  

  181 gttcttatagggtttcggtcacgtgttgag
                                    

KEYS (in order of precedence):
>>>>>> left primer


ADDITIONAL OLIGOS
                    start  len      tm     gc%   any    3' seq 
 1 LEFT_PRIMER         39   20   59.95   50.00  3.00  2.00 ttcgcaagacccttcctcta
 2 LEFT_PRIMER         81   20   59.81   55.00  2.00  2.00 ggagaggacacgctgaaatc
 3 LEFT_PRIMER         30   20   59.69   55.00  4.00  0.00 ccactatccttcgcaagacc
 4 LEFT_PRIMER         29   20   59.69   55.00  4.00  2.00 cccactatccttcgcaagac

Statistics
         con   too    in    in          no    tm    tm  high  high        high      
         sid  many   tar  excl   bad    GC   too   too   any    3'  poly   end      
        ered    Ns   get   reg   GC% clamp   low  high compl compl     X  stab    ok
Left    1692     0     0     0     1     0   958   355    16    80     0    28   254
primer3 release 0.9


(primer3_www_results.cgi v 0.2)