Primer3 Output


PRIMER PICKING RESULTS FOR ali2.seq

No mispriming library specified
Using 1-based sequence positions
OLIGO            start  len      tm     gc%   any    3' seq 
RIGHT_PRIMER        77   20   60.13   45.00  4.00  3.00 tttgcgctcttgaggaactt
SEQUENCE SIZE: 117
INCLUDED REGION SIZE: 117

    1 atgcttctcgctattgccttcttggcatcagtttgcgtgtcttccatgggaatcggcaag
                                                               <<<

   61 ttcctcaagagcgcaaagaagtttggcaaggccttcgtgaagatcctgaactcctaa
      <<<<<<<<<<<<<<<<<                                        

KEYS (in order of precedence):
<<<<<< right primer


ADDITIONAL OLIGOS
                    start  len      tm     gc%   any    3' seq 
 1 RIGHT_PRIMER        70   20   59.81   45.00  3.00  1.00 tcttgaggaacttgccgatt
 2 RIGHT_PRIMER        69   20   59.81   50.00  3.00  3.00 cttgaggaacttgccgattc
 3 RIGHT_PRIMER        95   20   60.24   45.00  8.00  1.00 aaggccttgccaaacttctt
 4 RIGHT_PRIMER        94   20   60.24   45.00  6.00  2.00 aggccttgccaaacttcttt

Statistics
         con   too    in    in          no    tm    tm  high  high        high      
         sid  many   tar  excl   bad    GC   too   too   any    3'  poly   end      
        ered    Ns   get   reg   GC% clamp   low  high compl compl     X  stab    ok
Right    709     0     0     0     0     0    72   429     0    38     0    28   142
primer3 release 0.9


(primer3_www_results.cgi v 0.2)