Data Examples from TIGR


I am currently getting data from TIGR as FTPd fasta formatted sequence which looks like this:

>TOVAD26TV

GCAAGGTTGGCGCTTGGTACCTGCCCCCCCCTCGAGTTTTTTTTTTTTTTTTTTTTTTTT

TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTGCCCACT

ATAATTTTTCCAAAACCTTCCTTTAATAGTAAATTCGATGGGTGGCCACAAAAATCCAAA

AAAAAAAACCTGCCCGGAAACAAGCTGGGCCAAAAGTGGGCCCCCAGCTTATCACTGAAA

GGTTGGGGCCCTGAAAAGGGTACCCCCCGCATATTCGCCCCGGAACCCCCTAATGGAACC

CCCCCTAGGGACCCGGGGCCGAACCCCGACTCGGGACTAGCCCCTGCGACGACGGGCAAC

ACGGCAGCCAGGGGGCTCCAATACAACAAAGAAACCCCTTCCAAAAACCCCAACCGGGGG

GCCATGTGTAATCCCAAGATCAAAGGGCCCCTGAATACCAAACCCCAAGGGGGGGGGCTA

ACTGGAGTCCCTTTTAAAAAACCCGAATACCCAAACCTCAAAACCCCCCTCAAAAAGGGG

GAAAGCTTTCACCCCTCTGGGCGGCCCATAGGGAGCTCTCTTTGAAAAACGCCGCGGTTC

CAAAGGCCCCCCAAAAATCCCCGGCCTGAAAAAAAACAGGGGTACCCCCCGTTCAATGGG

CCCAAAACATTCCCCGCCCTGGGGAAAAAAACCCCGCTTTTCCCCGCGGGGGAATTTGGG

GGACAGCCTCTGGGCCCGGGAACCCCCAAGGGGACCGCCCACATCTTTTATGGAACCCGG

GGGCTCCCCGGGAAAAATTTTTAGAGGGGGGCAACAGATTTGGAGGGCCCCCC

 

However, we anticipate receiving chromatographs directly from TIGR in the near future. In this case, we would need to: run phred and get the fasta formatted sequence from the phred output.

We also receive TIGR assembler output from TIGR. I'll write that up when I get to the contig table definition.


Andreas Matern